Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU040951

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSD, RP11-295K3.1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tung-Yi Lin et al.
International journal of molecular sciences, 21(17) (2020-08-28)
Poor prognosis due to the high relapse and metastasis rates of breast cancer has been particularly linked to the luminal B subtype. The current study utilized MCF-7 and ZR-75-1 to investigate various luminal subtypes of breast cancers that have discrepant
Satoshi Kitazawa et al.
Cancer science, 108(6), 1185-1193 (2017-03-21)
Vacuolar (H
C S F Oliveira et al.
Cell death & disease, 6, e1788-e1788 (2015-06-19)
Acetate is a short-chain fatty acid secreted by Propionibacteria from the human intestine, known to induce mitochondrial apoptotic death in colorectal cancer (CRC) cells. We previously established that acetate also induces lysosome membrane permeabilization in CRC cells, associated with release
Lin Cui et al.
Frontiers in cell and developmental biology, 8, 31-31 (2020-03-03)
Lysosomal membrane permeabilization (LMP) has recently been recognized as an important cell death pathway in various cell types. However, studies regarding the correlation between LMP and cardiomyocyte death are scarce. Lysosomal membrane-associated protein 2 (Lamp2) is an important component of
Morten P Oksvold et al.
Clinical therapeutics, 36(6), 847-862 (2014-06-24)
Exosomes are small (30- to 100-nm) vesicles secreted by all cell types in culture and found in most body fluids. A mean of 1 mL of blood serum, derived from healthy donors, contains approximately 10(12) exosomes. Depending on the disease

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service