MilliporeSigma
All Photos(1)

Documents

EHU084101

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFB2

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCACCTCCACATATACCAGTGGTGATCAGAAAACTATAAAGTCCACTAGGAAAAAAAACAGTGGGAAGACCCCACATCTCCTGCTAATGTTATTGCCCTCCTACAGACTTGAGTCACAACAGACCAACCGGCGGAAGAAGCGTGCTTTGGATGCGGCCTATTGCTTTAGAAATGTGCAGGATAATTGCTGCCTACGTCCACTTTACATTGATTTCAAGAGGGATCTAGGGTGGAAATGGATACACGAACCCAAAGGGTACAATGCCAACTTCTGTGCTGGAGCATGCCCGTATTTATGGAGTTCAGACACTCAGCACAGCAGGGTCCTGAGCTTATATAATACCATAAATCCAGAAGCATCTGCTTCTCCTTGCTGCGTGTCCCAAGATTTAGAACCTCTAACCATTCTCTACTACATTGGCAAAACACCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU016801EHU093641EHU019581
MISSION® esiRNA targeting human TGFB2

EHU084101

MISSION® esiRNA

MISSION® esiRNA targeting human TGFB1

EHU016801

MISSION® esiRNA

MISSION® esiRNA targeting human TGFB1I1

EHU093641

MISSION® esiRNA

MISSION® esiRNA targeting human TFAP2C

EHU019581

MISSION® esiRNA

Ensembl | human accession no.

ENSG00000092969

Ensembl | human accession no.

ENSG00000105329

Ensembl | human accession no.

ENSG00000140682

Ensembl | human accession no.

ENSG00000087510

esiRNA cDNA target sequence

TGGCACCTCCACATATACCAGTGGTGATCAGAAAACTATAAAGTCCACTAGGAAAAAAAACAGTGGGAAGACCCCACATCTCCTGCTAATGTTATTGCCCTCCTACAGACTTGAGTCACAACAGACCAACCGGCGGAAGAAGCGTGCTTTGGATGCGGCCTATTGCTTTAGAAATGTGCAGGATAATTGCTGCCTACGTCCACTTTACATTGATTTCAAGAGGGATCTAGGGTGGAAATGGATACACGAACCCAAAGGGTACAATGCCAACTTCTGTGCTGGAGCATGCCCGTATTTATGGAGTTCAGACACTCAGCACAGCAGGGTCCTGAGCTTATATAATACCATAAATCCAGAAGCATCTGCTTCTCCTTGCTGCGTGTCCCAAGATTTAGAACCTCTAACCATTCTCTACTACATTGGCAAAACACCCAA

esiRNA cDNA target sequence

GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC

esiRNA cDNA target sequence

GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCCAAAGGCCTCTGTGGCTCCTGCAATAA

esiRNA cDNA target sequence

CGCTCCTCAGCTCTACGTCTAAATACAAAGTGACAGTGGCTGAAGTACAGAGGCGACTGTCCCCACCTGAATGCTTAAATGCCTCGTTACTGGGAGGTGTTCTCAGAAGAGCCAAATCGAAAAATGGAGGCCGGTCCTTGCGGGAGAAGTTGGACAAGATTGGGTTGAATCTTCCGGCCGGGAGGCGGAAAGCCGCTCATGTGACTCTCCTGACATCCTTAGTAGAAGGTGAAGCTGTTCATTTGGCTAGGGACTTTGCCTATGTCTGTGAAGCCGAATTTCCTAGTAAACCAGTGGCAGAATATTTAACCAGACCTCATCTTGGAGGACGAAATGAGATGGCAGCTAGGAAGAACATGCTATTGGCGGCCCAGCAACTGTGTAAAGAATTCACAGAACTTCTCAGCCAAGACCGGACACCCCATGGGACCAGCAGGCTCGCCCCAGTCTTGGAGACGAACATACAGAACTGCTTGTCTCATTTCAGCCTGATTACCCACG

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

NCBI accession no.

NM_003238

NCBI accession no.

NM_000660

NCBI accession no.

NM_001042454

NCBI accession no.

NM_003222

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Joseph Yusup Shin et al.
Science translational medicine, 11(497) (2019-06-21)
In systemic sclerosis (SSc), previously healthy adults develop an inflammatory prodrome with subsequent progressive fibrosis of the skin and viscera. SSc has a weak signature for genetic contribution, and there are few pathogenic insights or targeted treatments for this condition.
Ruijing Lu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6691-6700 (2015-03-31)
A large body of evidence indicates that microRNAs play a critical role in tumor initiation and progression by negatively regulating oncogenes or tumor suppressor genes. Here, we report that the expression of miR-200a was notably downregulated in 45 renal cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service