Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU089291

Sigma-Aldrich

MISSION® esiRNA

targeting human NKX3-1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGATCGAGTTGGAGAGGAAGTTCAGCCATCAGAAGTACCTGTCGGCCCCTGAACGGGCCCACCTGGCCAAGAACCTCAAGCTCACGGAGACCCAAGTGAAGATATGGTTCCAGAACAGACGCTATAAGACTAAGCGAAAGCAGCTCTCCTCGGAGCTGGGAGACTTGGAGAAGCACTCCTCTTTGCCGGCCCTGAAAGAGGAGGCCTTCTCCCGGGCCTCCCTGGTCTCCGTGTATAACAGCTATCCTTACTACCCATACCTGTACTGCGTGGGCAGCTGGAGCCCAGCTTTTTGGTAATGCCAGCTCAGGTGACAACCATTATGATCAAAAACTGCCTTCCCCAGGGTGTCTCTATGAAAAGCACAAGGGGCCAAGGTCAGGGAGCAAGAGGTGTGCACACCAAAGCTATTGGAGATTTGCGTGG

Ensembl | human accession no.

ENSG00000167034

NCBI accession no.

NM_006167

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NKX3-1(4824) , NKX3-1(4824)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nathan A Damaschke et al.
Cancer research, 77(19), 5236-5247 (2017-08-05)
Loss of imprinting (LOI) is an epigenetic event that relaxes an allele-specific restriction on gene expression. One gene that experiences LOI is the paracrine insulin-like growth factor IGF2, which occurs commonly in human prostate tissues during aging and tumorigenesis. However
Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xue Bai et al.
Oncology reports, 33(6), 3085-3092 (2015-05-13)
Cervical cancer is the second most common women carcinoma worldwide and the fourth leading cause of cancer-associated mortality in women. Butein, a bioactive flavonoid isolated from numerous native plants, has been shown to induce apoptosis and inhibits migration and invasion
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service