Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU091501

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB27A

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACCATCCCCATTAGACCTACGAATAAAGCATCCGGTTCTAAAATTAATTTGTTGCAGCTTTGTAAATATTTCTTTAAGATTCAGCCTGAGAGTTAGGAGAAATATTTCAGAGCCAAAAGTGCCTTATACAACCTTAGCCTATTATAGTAAATCATTCAAGGATTCAGAATTTTGCAGTCACAGAAGAGTGTATTTATTATGTAGAATGAATGAGGGTACTGTCACCTGCCTTAATGTAGGTAGGCCCAGAGTCTTACATTTAAGATCTTACATGCAGTTATAAAACCGCCACAGTCTTCAATCCAGATTTGAAGACTCATGCCATAGGTGACATTCTAAAATACCATTAAAGCCACTTAAATGTTAAATAAGAATATACATGCACATCAGCTCAATGT

Ensembl | human accession no.

ENSG00000069974

NCBI accession no.

NM_004580

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAB27A(5873) , RAB27A(5873)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dajiang Guo et al.
International journal of cancer, 144(12), 3070-3085 (2018-12-18)
Despite recent advances in targeted and immune-based therapies, advanced stage melanoma remains a clinical challenge with a poor prognosis. Understanding the genes and cellular processes that drive progression and metastasis is critical for identifying new therapeutic strategies. Here, we found
Meng Shen et al.
Cancer research, 79(14), 3608-3621 (2019-05-24)
Cancer-secreted, extracellular vesicle (EV)-encapsulated miRNAs enable cancer cells to communicate with each other and with noncancerous cells in tumor pathogenesis and response to therapies. Here, we show that treatment with a sublethal dose of chemotherapeutic agents induces breast cancer cells
Hye-Jin Boo et al.
Nature communications, 7, 12961-12961 (2016-09-27)
Nicotinic acetylcholine receptors (nAChRs) binding to the tobacco-specific carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) induces Ca2+ signalling, a mechanism that is implicated in various human cancers. In this study, we investigated the role of NNK-mediated Ca2+ signalling in lung cancer formation. We show
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Enyong Dai et al.
Autophagy, 16(11), 2069-2083 (2020-01-11)
KRAS is the most frequently mutated oncogene in human neoplasia. Despite a large investment to understand the effects of KRAS mutation in cancer cells, the direct effects of the oncogenetic KRAS activation on immune cells remain elusive. Here, we report
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service