Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU105041

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGGGTGAAGAATGGAAGGGTTATGTGGTCCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGAAGCAGGGTGTCTTGACCCATGGCCGTGTCCGCCTGCTACTGAGTAAGGGGCATTCCTGTTACAGACCAAGGAGAACTGGAGAAAGAAAGAGAAAATCAGTTCGTGGTTGCATTGTGGATGCAAATCTGAGCGTTCTCAACTTGGTTATTGTAAAAAAAGGAGAGAAGGATATTCCTGGACTGACTGATACTACAGTGCCTCGCCGCCTGGGCCCCAAAAGAGCTAGCAGAATCCGCAAACTTTTCAATCTCTCTAAAGAAGATGATGTCCGCCAGTATGTTGTAAGAAAGCCCTTAAATAAAGAAGGTAAGAAACCTAGGACCAAAGCACCCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yun Zou et al.
Oncotarget, 8(13), 20825-20833 (2017-02-18)
Renal cell carcinoma (RCC) is a urologic malignant cancer and often diagnosed at an advanced stage, which results in high mortality. Targeted therapy may improve the quality of life and survival of patients who are not suitable for nephrectomy. Everolimus
Atsuko Tsukimoto et al.
Antiviral research, 117, 1-9 (2015-02-11)
Previous studies have demonstrated that cyclopentenone prostaglandins (cyPGs) inhibit the replication of a wide variety of DNA and RNA viruses in different mammalian cell types. We investigated a new role for prostaglandin A1 (PGA1) in the inhibition of hepatitis C
Lingqin Yuan et al.
Endocrine-related cancer, 22(4), 577-591 (2015-06-06)
Glutamine is one of the main nutrients used by tumor cells for biosynthesis. Therefore, targeted inhibition of glutamine metabolism may have anti-tumorigenic implications. In the present study, we aimed to evaluate the effects of glutamine on ovarian cancer cell growth.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service