Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU108151

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT5A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGTGGAACCTGAAACCATTCACCACGCGGGATTTCTCCATCAGGTCCCTGGCTGACCGGCTGGGGGACCTGAGCTATCTCATCTATGTGTTTCCTGACCGCCCCAAGGATGAGGTCTTCTCCAAGTACTACACTCCTGTGCTGGCTAAAGCTGTTGATGGATATGTGAAACCACAGATCAAGCAAGTGGTCCCTGAGTTTGTGAATGCATCTGCAGATGCTGGGGGCAGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTGTGTGCCCCCAGGCTCCCTATAACATGTACCCACAGAACCCTGACCATGTACTCGATCAGGATGGAGAATTCGACCTGGATGAGACCATGGATGTGGCCAGGCACGTGGAGGAACTCTTACGCCGACCAATGGACAGTCTTGACTCCCGCCTCTCGCCCCCTGCCGGTCTTTTCACCTCTGCCAGAGGCTCCCTCTCATGAATGTTTGAATCCCACGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhengzheng Xiao et al.
International journal of molecular medicine, 47(1), 113-124 (2020-11-07)
As hyperprolactinemia is observed in patients with bromocriptine‑resistant prolactinoma, prolactin (PRL) has been implicated in the development of bromocriptine resistance. Since PRL primarily mediates cell survival and drug resistance via the Janus kinase‑2 (JAK2)/signal transducer and activator of transcription 5A (STAT5) signaling pathway
Sean M Holloran et al.
Molecular and cellular endocrinology, 511, 110859-110859 (2020-05-15)
Progesterone and prolactin are two key hormones involved in development and remodeling of the mammary gland. As such, both hormones have been linked to breast cancer. Despite the overlap between biological processes ascribed to these two hormones, little is known
Baosheng Wang et al.
In vitro cellular & developmental biology. Animal, 56(3), 243-252 (2020-02-23)
The prolactin/STAT5 and AKT1/mTOR pathways play a key role in milk protein transcription and translation, respectively. However, the correlation between them in bovine mammary epithelial cells remains unclear. Here, mRNA and protein expression levels of AKT1, STAT5, and mTOR and
Dharmalingam Subramaniam et al.
Cell death & disease, 11(2), 149-149 (2020-02-26)
Osteosarcoma (OS) is the most common primary bone tumor that primarily affects children and adolescents. Studies suggested that dysregulation JAK/STAT signaling promotes the development of OS. Cells treated with pimozide, a STAT5 inhibitor suppressed proliferation and colony formation and induced

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service