Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU129311

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM10

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGAACTCTGCCATTTCACTCTGTCATTTATCATGAAGATGATATTAACTATCCCCATAAATACGGTCCTCAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGAATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGATACCTCAAGAAGAACATGCTGCTAATGGTCCAGAACTTCTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATTTGTTCTTTAAATATTACGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATTGATACAATTTACCAGACCACAGACTTCTCCGGAATCCGTAACATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTGCTGATGAGAAGGACCCTACAAATCCTTTCCGTTTCCC

Ensembl | human accession no.

ENSG00000137845

NCBI accession no.

NM_001110

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADAM10(102) , ADAM10(102)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zikang Xie et al.
Environmental toxicology, 35(8), 867-878 (2020-03-22)
MiR-20a has been reported as a key regulator to pro-inflammatory factor release in fibroblast-like synoviocytes (FLS), which caused rheumatoid arthritis (RA). However, the molecular mechanism of miR-20a in RA remains to be further elucidated. This study aimed to investigate the
Zhuo-peng Ye et al.
PloS one, 9(8), e105350-e105350 (2014-08-16)
CD8+ T cells play an important role in the anti-tumor activities of the body. The dysfunction of CD8+ T cells in glioma is unclear. This study aims to elucidate the glioma cell-derived ADAM10 (A Disintegrin and metalloproteinase domain-containing protein 10)
Wen Wu et al.
Inflammation, 43(2), 673-685 (2019-12-18)
Aseptic loosening (AL) is the most frequent cause of failure of total hip arthroplasties (THA). Prosthetic wear particle-induced monocyte recruitment to the periprosthetic tissue and subsequent inflammatory response are thought to be the major contribution to AL. Fibroblast is a
Peihang Jing et al.
Experimental and molecular pathology, 100(1), 132-138 (2015-12-26)
MicroRNAs (miRNAs) are small non-coding RNAs of approximately 22 nucleotides that negatively regulate gene expression at the post-transcriptional level. Downexpression of miR-140-5p was reported in some human cancers, and combined with a reduction of cell migration and invasion, suggesting that
Jun Lu et al.
Cancer management and research, 12, 9577-9587 (2020-10-17)
Non-small cell lung cancer (NSCLC) remains the most commonly diagnosed malignancy and the leading cause of cancer death worldwide. Circular RNAs (circRNAs) have been demonstrated to play critical roles in human carcinogenesis, including NSCLC. However, it is still unclear whether
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service