MilliporeSigma
All Photos(1)

Documents

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU026781EHU055471EHU009351
MISSION® esiRNA targeting human FASN

EHU130711

MISSION® esiRNA

MISSION® esiRNA targeting human FARSA

EHU026781

MISSION® esiRNA

MISSION® esiRNA targeting human FAU

EHU055471

MISSION® esiRNA

MISSION® esiRNA targeting human FAT2

EHU009351

MISSION® esiRNA

Ensembl | human accession no.

ENSG00000169710

Ensembl | human accession no.

ENSG00000179115

Ensembl | human accession no.

ENSG00000149806

Ensembl | human accession no.

ENSG00000086570

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

esiRNA cDNA target sequence

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

esiRNA cDNA target sequence

AGACAGAGCTGAGCCCAGAGATGATCTCCAGTGGCTCTTGGCGGGACCGGCCCTTCAAGCCCTACAACTTCTTGGCCCACGGTGTCCTCCCCGACAGCGGCCACCTTCACCCGCTGCTCAAGGTCCGCTCCCAGTTCCGACAGATCTTCCTGGAGATGGGGTTCACCGAGATGCCGACTGATAACTTCATTGAGAGCTCCTTCTGGAACTTTGACGCCCTCTTCCAGCCCCAGCAGCACCCAGCCCGTGACCAGCACGACACCTTCTTCCTTCGAGATCCAGCGGAGGCCCTGCAGCTCCCAATGGACTATGTCCAGCGGGTCAAGCGGACCCACTCTCAGGGCGGCTACGGCTCACAGGGGTACAAGTATAACTGGAAGCTGGACGAGGCCCGGAAAAACCTACTGCGAACCCACAC

esiRNA cDNA target sequence

AGTCGCCAATATGCAGCTCTTTGTCCGCGCCCAGGAGCTACACACCTTCGAGGTGACCGGCCAGGAAACGGTCGCCCAGATCAAGGCTCATGTAGCCTCACTGGAGGGCATTGCCCCGGAAGATCAAGTCGTGCTCCTGGCAGGCGCGCCCCTGGAGGATGAGGCCACTCTGGGCCAGTGCGGGGTGGAGGCCCTGACTACCCTGGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTCCATGGTTCCCTGGCCCGTGCTGGAAAAGTGAGAGGTCAGACTCCTAAGGTGGCCAAACAGGAGAAGAAGAAGAAGAAGACAGGTCGGGCTAAGCGGCGGATGCAGTACAACCGGCGCTTTGTCAACGTTGTGCCCACCTTTGGCAAGAAGAAGG

esiRNA cDNA target sequence

AAGGAGATCCCCCACTCACTGGTGAAACCCTTGTGGTTGTCAATGTGTCTGATATCAATGACAACCCCCCAGAGTTCAGACAACCTCAATATGAAGCCAATGTCAGTGAACTGGCAACCTGTGGACACCTGGTTCTTAAAGTCCAGGCTATTGACCCTGACAGCAGAGACACCTCCCGCCTGGAGTACCTGATTCTTTCTGGCAATCAGGACAGGCACTTCTTCATTAACAGCTCATCGGGAATAATTTCTATGTTCAACCTTTGCAAAAAGCACCTGGACTCTTCTTACAATTTGAGGGTAGGTGCTTCTGATGGAGTCTTCCGAGCAACTGTGCCTGTGTACATCAACACTACAAATGCCAACAAGTACAGCCCAGAGTTCCAGCAGCACCTTTATGAGGCAGAATTAGCAGAGAATGCAATGGTTGGAACC

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

NCBI accession no.

NM_004104

NCBI accession no.

NM_004461

NCBI accession no.

NM_001997

NCBI accession no.

NM_001447

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Xing Zhong et al.
Oncology letters, 21(4), 245-245 (2021-03-06)
Diffuse large B-cell lymphoma (DLBCL) is the most common and heterogeneous lymphoid malignancy. The subtype with MYC and BCL-2 double-expressor lymphoma (DEL) was defined by its aggressive nature and poor survival outcome. Therefore, the development of effective therapies for the
Débora C Bastos et al.
The Journal of pathology, 253(3), 292-303 (2020-11-10)
Loss of the tumor suppressor gene Pten in murine prostate recapitulates human carcinogenesis and causes stromal proliferation surrounding murine prostate intraepithelial neoplasia (mPIN), which is reactive to microinvasion. In turn, invasion has been shown to be regulated in part by
Valeryia Mikalayeva et al.
International journal of molecular sciences, 20(6) (2019-03-21)
Both cytosolic fatty acid synthesis (FAS) and mitochondrial fatty acid oxidation (FAO) have been shown to play a role in the survival and proliferation of cancer cells. This study aimed to confirm experimentally whether FAS and FAO coexist in breast
Dan Cao et al.
Liver international : official journal of the International Association for the Study of the Liver, 37(1), 80-89 (2016-06-07)
Although it is well established that fatty acids (FA) are indispensable for the proliferation and survival of cancer cells in hepatocellular carcinoma (HCC), inhibition of Fatty Acid Synthase (FASN) cannot completely repress HCC cell growth in culture. Thus, we hypothesized

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service