Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU131781

Sigma-Aldrich

MISSION® esiRNA

targeting human MUL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGAAGCTCCAGGAAAATGCGTGCCTTATGCTGTTATAGAAGGAGCTGTGCGGTCTGTTAAAGAAACGCTTAACAGCCAGTTTGTGGAAAACTGCAAGGGGGTAATTCAGCGGCTGACACTTCAGGAGCACAAGATGGTGTGGAATCGAACCACCCACCTTTGGAATGATTGCTCAAAGATCATTCATCAGAGGACCAACACAGTGCCCTTTGACCTGGTGCCCCACGAGGATGGCGTGGATGTGGCTGTGCGAGTGCTGAAGCCCCTGGACTCAGTGGATCTGGGTCTAGAGACTGTGTATGAGAAGTTCCACCCCTCGATTCAGTCCTTCACCGATGTCATCGGCCACTACATCAGCGGTGAGCGGCCCAAAGGCATCCAAGAGACCGAGGAGATGCTGAAGGTGGGGGCCACCCTCACAGGGGTTGGCGAACTGGTCCTGGACAACAACTCTGTCCGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sun-Yong Kim et al.
Oncotarget, 6(32), 33382-33396 (2015-10-10)
Recent research on non-thermal plasma (NTP, an ionized gas) has identified it as a novel cancer therapeutic tool. However, the molecular mechanism remains unclear. In this study, we demonstrated NTP induced cell death of head and neck cancer (HNC) through
Yanfang Zhao et al.
Biochimica et biophysica acta, 1863(11), 2871-2881 (2017-08-08)
The pathogenesis of cardiac hypertrophy is tightly associated with mitochondrial dysfunction. Disequilibrium of mitochondrial dynamic is one of the main drivers in the pathological processes during development of various cardiac diseases. However, the effect of mitochondrial dynamics on cardiac hypertrophy
Jina Yun et al.
eLife, 3, e01958-e01958 (2014-06-06)
Parkinson's disease (PD) genes PINK1 and parkin act in a common pathway that regulates mitochondrial integrity and quality. Identifying new suppressors of the pathway is important for finding new therapeutic strategies. In this study, we show that MUL1 suppresses PINK1
Rajat Puri et al.
Nature communications, 10(1), 3645-3645 (2019-08-15)
Chronic mitochondrial stress associates with major neurodegenerative diseases. Recovering stressed mitochondria constitutes a critical step of mitochondrial quality control and thus energy maintenance in early stages of neurodegeneration. Here, we reveal Mul1-Mfn2 pathway that maintains neuronal mitochondrial integrity under stress

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service