Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU142811

Sigma-Aldrich

MISSION® esiRNA

targeting human ROR2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGAAGTGGAGGTTCTGGATCCGAACGACCCTTTAGGACCCCTTGATGGGCAGGACGGCCCGATTCCAACTCTGAAAGGTTACTTTCTGAATTTTCTGGAGCCAGTAAACAATATCACCATTGTCCAAGGCCAGACGGCAATTCTGCACTGCAAGGTGGCAGGAAACCCACCCCCTAACGTGCGGTGGCTAAAGAATGATGCCCCGGTGGTGCAGGAGCCGCGGCGGATCATCATCCGGAAGACAGAATATGGTTCACGACTGCGAATCCAGGACCTGGACACGACAGACACTGGCTACTACCAGTGCGTGGCCACCAACGGGATGAAGACCATTACCGCCACTGGCGTCCTGTTTGTGCGGCTGGGTCCAACGCACAGCCCAAATCATAACTTTCAGGATGATTACCACGAGGATGGGT

Ensembl | human accession no.

ENSG00000169071

NCBI accession no.

NM_004560

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ROR2(4920) , ROR2(4920)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dongli Liu et al.
Scientific reports, 10(1), 13906-13906 (2020-08-19)
ROR1 and ROR2 are receptor tyrosine kinases with altered expression in a range of cancers. Silencing ROR1 or ROR2 in different tumour types has been shown to inhibit proliferation and decrease metastatic potential. The aim of this study was to
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Atsuko Ishizuya-Oka et al.
PloS one, 9(9), e107611-e107611 (2014-09-12)
Amphibian intestinal remodeling, where thyroid hormone (T3) induces some larval epithelial cells to become adult stem cells analogous to the mammalian intestinal ones, serves as a unique model for studying how the adult stem cells are formed. To clarify its
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service