Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU149061

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGAAGCAGGACATCAGCATCCCCGACTACTGCAGCCTGGGCGATGGGGAGGAGGAGGAAATCACCATCAATGCCTGGTTTGGTCCCCAGGGAACCATCTCCCCACTACATCAGGATCCCCAGCAAAACTTCCTAGTGCAGGTGATGGGGAGGAAGTACATCCGGCTGTATTCCCCGCAGGAGTCAGGGGCTCTGTACCCTCATGACACGCACCTTCTCCATAACACGAGCCAGGTTGACGTGGAGAATCCCGACCTGGAAAAGTTCCCCAAGTTTGCCAAGGCCCCATTCCTGTCCTGCATCCTGTCTCCTGGAGAGATCCTGTTCATCCCGGTGAAATACTGGCATTACGTGCGGGCTCTGGATTTGAGCTTCTCGGTCAGCTTCTGGTGGTCGTAGCCAGGATAGGAGCTGAAAGGGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

JMJD5 (jumonji domain-containing protein 5) exhibits histone H3 lysine 36 dimethylation (H3K36me2) demethylase activity and thereby is associated with gene transcription regulation. In addition, it also has hydroxylase activity and controls osteoclastogenesis. It is linked with cell cycle progression in breast cancer cells, chromosome segregation with the help of RCCD1 (RCC1 domain-containing protein 1), metabolism by controlling PKM2 (pyruvate kinase muscle isozyme) nuclear translocation, microtubule stability and mitotic progression. It also participates in HBV (Hepatitis B virus) replication.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

JMJD5 (Jumonji Domain-containing 5) Associates with Spindle Microtubules and Is Required for Proper Mitosis.
He Z
The Journal of Biological Chemistry, 291, 4684-4684 (2016)
Ru Zhang et al.
International journal of clinical and experimental pathology, 8(6), 6482-6489 (2015-08-12)
To observe the effects of Jumonji C domain-containing (JMJD) 5 depletion on colon cancer (CC). A short-hairpin RNA targeting JMJD5 was transfected into a lentivirus to make Lv-shJMJD5 for infection into the Caco-2 human cell. Besides, a negative control shRNA
Takahisa Kouwaki et al.
Journal of virology, 90(7), 3530-3542 (2016-01-23)
Hepatitis B virus (HBV) is a causative agent for chronic liver diseases such as hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). HBx protein encoded by the HBV genome plays crucial roles not only in pathogenesis but also in replication of HBV.
Jing Shen et al.
EMBO reports, 18(12), 2131-2143 (2017-10-07)
The histone H3 N-terminal protein domain (N-tail) is regulated by multiple posttranslational modifications, including methylation, acetylation, phosphorylation, and by proteolytic cleavage. However, the mechanism underlying H3 N-tail proteolytic cleavage is largely elusive. Here, we report that JMJD5, a Jumonji C

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service