MilliporeSigma
All Photos(1)

Documents

EHU154611

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNA3

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTCTCCTTCGAACTGCTGGTGCGGTTCTTCGCTTGTCCTAGCAAAGCCACCTTCTCGCGAAACATCATGAACCTGATCGACATTGTGGCCATCATTCCTTATTTTATCACTCTGGGTACCGAGCTGGCCGAACGACAGGGCAATGGACAGCAGGCCATGTCTCTGGCCATCCTGAGGGTCATCCGCCTGGTAAGGGTCTTCCGCATCTTCAAGCTGTCGCGCCACTCCAAGGGGCTGCAGATCCTCGGGCAAACGCTGAAGGCGTCCATGCGGGAGCTGGGATTGCTCATCTTCTTCCTCTTTATTGGGGTCATCCTTTTCTCCAGCGCGGTCTACTTTGCCGAGGCAGACGACCCCACTTCAGGTTTCAGCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTAACCATGACAACAGTGGGTTACGGCGATATGCACCCAGTGACCATAGGGGGCAAGATTGTGGGATCTCTCTGTGCCATCGCCGGTGTCTTGACCATCGCATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Xiao-Hong Kan et al.
Archives of biochemistry and biophysics, 591, 150-156 (2016-01-10)
Ion channels expressed in macrophages have been tightly related to atherosclerosis by coupling cellular function. How the voltage-gated potassium channels (Kv) affect macrophage migration remain unknown. The aim of our study is to investigate whether Kv1.3-ERK signaling pathway plays an
Marat Khodoun et al.
Science advances, 6(47) (2020-11-20)
Lupus nephritis (LN) is an autoimmune disease with substantial morbidity/mortality and limited efficacy of available therapies. Memory T (Tm) lymphocytes infiltrate LN kidneys, contributing to organ damage. Analysis of LN, diabetic nephropathy, and healthy donor kidney biopsies revealed high infiltration
Roberta Peruzzo et al.
Redox biology, 37, 101705-101705 (2020-10-03)
The potassium channel Kv1.3, involved in several important pathologies, is the target of a family of psoralen-based drugs whose mechanism of action is not fully understood. Here we provide evidence for a physical interaction of the mitochondria-located Kv1.3 (mtKv1.3) and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service