Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU030751

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGTCAAAGGAGGTAGCAAGTGCATCAAATACCTGCTCTTCGGATTTAACTTCATCTTCTGGCTCGCTGGCATTGCAGTGCTTGCTATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCAAGAGAATAACCATTCCAGTTTCTACACAGGAGTGTACATTCTGATTGGAGCCGGGGCCCTCATGATGCTGGTTGGTTTCCTGGGCTGCTGTGGAGCTGTACAAGAGTCCCAGTGCATGCTGGGATTGTTCTTCGGGTTCCTCTTGGTGATATTCGCCATTGAGATAGCCGCCGCCGTCTGGGGCTATACCCACAAGGATGAGGTGATTAAAGAACTCCAGGAGTTTTACAAGGACACCTACCAAAAGTTACGGAGCAAGGATGAACCCCAGCGGGAAACACTCAAAGCCATCCATATGGCGTTGGACTGCTGTGGCATAGCTGGTCCTTTGGAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

Storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Germana Rappa et al.
Oncotarget, 6(10), 7970-7991 (2015-03-13)
Interaction of breast cancer cells (BCCs) with stromal components is critical for tumor growth and metastasis. Here, we assessed the role of CD9 in adhesion, migration and invasiveness of BCCs. We used co-cultures of BCCs and bone marrow-derived multipotent mesenchymal
Gong-Ping Wang et al.
Molecular medicine reports, 12(1), 1381-1386 (2015-03-12)
The tetraspanin CD9 has previously been shown to be involved in various cellular activities, including proliferation and migration. In addition, CD9 has been shown to be associated with epidermal growth factor receptor (EGFR). A common characteristic of glioblastoma multiforme histology
Michael J Herr et al.
PloS one, 9(9), e106999-e106999 (2014-09-04)
The most prevalent cardiovascular diseases arise from alterations in vascular smooth muscle cell (VSMC) morphology and function. Tetraspanin CD9 has been previously implicated in regulating vascular pathologies; however, insight into how CD9 may regulate adverse VSMC phenotypes has not been
Jian Huan et al.
International journal of clinical and experimental pathology, 8(3), 3054-3061 (2015-06-06)
Esophageal squamous cell carcinoma (ESCC) is one of the leading causes of cancer deaths worldwide. CD9 has been reported to play a critical role in cell motility, growth and metastasis of multiple cancers. The present study investigated the clinicopathological features

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service