MilliporeSigma
All Photos(1)

Documents

EMU082481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat3

Sign Into View Organizational & Contract Pricing

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATATGCAGCCAGCAAAGAGTCACATGCCACGTTGGTGTTTCATAATCTCTTGGGTGAAATTGACCAGCAATATAGCCGATTCCTGCAAGAGTCCAATGTCCTCTATCAGCACAACCTTCGAAGAATCAAGCAGTTTCTGCAGAGCAGGTATCTTGAGAAGCCAATGGAAATTGCCCGGATCGTGGCCCGATGCCTGTGGGAAGAGTCTCGCCTCCTCCAGACGGCAGCCACGGCAGCCCAGCAAGGGGGCCAGGCCAACCACCCAACAGCCGCCGTAGTGACAGAGAAGCAGCAGATGTTGGAGCAGCATCTTCAGGATGTCCGGAAGCGAGTGCAGGATCTAGAACAGAAAATGAAGGTGGTGGAGAACCTCCAGGACGACTTTGATTTCAACTACAAAACCCTCAAGAGCCAAGGAGACATGCAGGATCTGAATGGAAACAACCAGTCTGTGACCAGACAGAAGATGCAGCAGCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU001941EMU071921EMU007971
vibrant-m

EMU082481

MISSION® esiRNA

vibrant-m

EMU001941

MISSION® esiRNA

vibrant-m

EMU071921

MISSION® esiRNA

vibrant-m

EMU007971

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

esiRNA cDNA target sequence

CATATGCAGCCAGCAAAGAGTCACATGCCACGTTGGTGTTTCATAATCTCTTGGGTGAAATTGACCAGCAATATAGCCGATTCCTGCAAGAGTCCAATGTCCTCTATCAGCACAACCTTCGAAGAATCAAGCAGTTTCTGCAGAGCAGGTATCTTGAGAAGCCAATGGAAATTGCCCGGATCGTGGCCCGATGCCTGTGGGAAGAGTCTCGCCTCCTCCAGACGGCAGCCACGGCAGCCCAGCAAGGGGGCCAGGCCAACCACCCAACAGCCGCCGTAGTGACAGAGAAGCAGCAGATGTTGGAGCAGCATCTTCAGGATGTCCGGAAGCGAGTGCAGGATCTAGAACAGAAAATGAAGGTGGTGGAGAACCTCCAGGACGACTTTGATTTCAACTACAAAACCCTCAAGAGCCAAGGAGACATGCAGGATCTGAATGGAAACAACCAGTCTGTGACCAGACAGAAGATGCAGCAGCTG

esiRNA cDNA target sequence

GAATGCCCAAGTCATGGAGTTACTTCAGCGTCTGCTCCAAAGGTCCTTTGTAGTAGAAACCCAGCCCTGCATGCCCCAGACTCTCCACCGACCCCTCATCCTGAAGACTGGGAACAAGTTCACCGTCCGAACAAGACTTCTGGTGAGACTCCAGGAAGGCAGCGAATCACTCAAAGCAGAAGTCTCTGTCGACAGGAATTCAGACTTACCAGGCTTCCGGAAGTTCAACATTCTGACCTCAAACCAAAAAACCTTGACCCCGGAGGAGGGCCAGAGACAGGGCTTAATTTGGGACTTCGGCTTCTTGACTCTGGTGGAGCAACGCGCTGTGGGTGCAGGAAAGGGCAACAAGGGGCCGCTGGCAGTGACAGAGGAGTTACATGTCATCAGCTTCGTGGTTGAG

esiRNA cDNA target sequence

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

esiRNA cDNA target sequence

GGTGAAAGTAAAGGCGTCCATTGACAAGAATGTTTCAACTCTAAGCAATAGAAGATTTGTGCTTTGTGGAACTCACGTCAAAGCTATGTCCAGTGAGGAATCTTCCAATGGGAGCCTCTCAGTGGAGTTTAGACATTTGCAACCCAAGGAGATGAAGTGCAGTACTGGGAGTAAAGGAAACGAGGGCTGCCACATGGTGACAGAGGAGTTGCATTCCATAACCTTTGAGACCCAGATCTGCCTCTATGGCCTCACCATTAACCTAGAGACCAGCTCATTACCTGTCGTGATGATTTCTAATGTCAGCCAACTACCTAATGCATGGGCATCCATCATTTGGTACAATGTATCAACTAACGACTCCCAGAACTTGGTTTTCTTTAATAACCCTCCATCTGTCACTTTGGGCCAAC

Ensembl | mouse accession no.

ENSMUSG00000004040

Ensembl | mouse accession no.

ENSMUSG00000040033

Ensembl | mouse accession no.

ENSMUSG00000026104

Ensembl | mouse accession no.

ENSMUSG00000062939

NCBI accession no.

NM_213659

NCBI accession no.

NM_019963

NCBI accession no.

NM_009283

NCBI accession no.

NM_011487

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Qiuping Zhao et al.
International immunopharmacology, 25(2), 242-248 (2015-02-15)
High-glucose-induced low-grade inflammation has been regarded as a key event in the onset and progression of endothelial dysfunction in diabetic vascular complications. Ginkgolide A (GA), a major compound from Ginkgo biloba extract, is widely used for the treatment of cardiovascular
Chunli Shao et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4154-4166 (2014-06-08)
Lung cancer stem cells (CSC) with elevated aldehyde dehydrogenase (ALDH) activity are self-renewing, clonogenic, and tumorigenic. The purpose of our study is to elucidate the mechanisms by which lung CSCs are regulated. A genome-wide gene expression analysis was performed to
Ling Qin et al.
American journal of translational research, 7(5), 878-890 (2015-07-16)
MiR-29b has been reported to function as a tumor suppressor in a variety of cancers. However, its role in the regulation of breast cancer is controversial. In this paper, we explored the expression of miR-29b in a cohort of 67
S Timme et al.
Oncogene, 33(25), 3256-3266 (2013-08-06)
Signal transducer and activator of transcription 3 (STAT3) is altered in several epithelial cancers and represents a potential therapeutic target. Here, STAT3 expression, activity and cellular functions were examined in two main histotypes of esophageal carcinomas. In situ, immunohistochemistry for
Anuradha Bandaru et al.
European journal of immunology, 44(7), 2013-2024 (2014-03-20)
We studied the factors that regulate IL-23 receptor expression and IL-17 production in human tuberculosis infection. Mycobacterium tuberculosis (M. tb)-stimulated CD4(+) T cells from tuberculosis patients secreted less IL-17 than did CD4(+) T cells from healthy tuberculin reactors (PPD(+) ).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service