콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU060821

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK9

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGGCATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGGATAGGGGAGGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGGTGCTGATGGCCCTCATCTCCAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGATTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTGGAGACAGGTGCGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTCTATGCCAGGCTGTGCTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCTAGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCTCAGCCAACCCGCTCCACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGGAACCAGAGGGGGCGTGCCTGCCAAGCTCACACAGCAGGAACTGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaohui Xu et al.
Experimental and therapeutic medicine, 13(5), 1993-1999 (2017-06-02)
Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of the subtilisin family of PCs that encodes a neural apoptosis-regulated convertase 1. However, the precise role of PCSK9 in lung cancer cell apoptosis has remained elusive. In the present study
Yanting Zou et al.
Inflammation, 43(1), 251-263 (2019-11-30)
Lipopolysaccharide (LPS) is demonstrated to cause "two-hit" injury to liver. Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays an important role in LPS clearance. Hepatocyte nuclear factor-1 alpha (HNF-1α) and sterol regulatory element-binding protein 2 (SREBP2) were reported to be responsible
Ga Eun Lee et al.
Frontiers in endocrinology, 11, 607144-607144 (2021-01-26)
The proprotein convertase subtilisin/kexin type 9 (PCSK9) has been implicated in the pathogenesis of inflammatory diseases. We sought to investigate the role of PCSK9 in the pathogenesis of Graves' orbitopathy (GO) and whether it may be a legitimate target for
Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors
Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.