콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU066621

Sigma-Aldrich

MISSION® esiRNA

targeting human ARID1A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

Ensembl | 인체 수납 번호

ENSG00000117713

NCBI 수납 번호

NM_006015

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ARID1A(8289) , ARID1A(8289)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yu-Chun Tseng et al.
Molecular reproduction and development, 84(12), 1250-1256 (2017-11-28)
Mammalian embryos undergo dramatic epigenetic remodeling that can have a profound impact on both gene transcription and overall embryo developmental competence. Members of the SWI/SNF (Switch/Sucrose non-fermentable) family of chromatin-remodeling complexes reposition nucleosomes and alter transcription factor accessibility. These large
Yan Yang et al.
Anti-cancer drugs, 31(4), 368-376 (2020-01-09)
Gastric cancer (GC) is lethal and there is an urgent need for improved understanding of this disease. Recent studies have reported that microRNAs (miRNAs) play increasingly important roles in the regulation of GC. In this study, we explored the target
Wen Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2420-2433 (2017-10-27)
We previously performed microRNA (miRNA) microarray to identify effective indicators of clear cell renal cell carcinoma (ccRCC) tissue samples and preoperative/postoperative plasma in which we identified miR-144-3p as an oncomiRNA. However, the molecular mechanism of miR-144-3p remains unclear. This study
Dakeun Lee et al.
OncoTargets and therapy, 10, 4153-4159 (2017-09-02)
The At-rich interactive domain 1A (ARID1A) is frequently mutated in gastric cancers (GCs) with a poor prognosis. Growing evidence indicates that loss of ARID1A expression leads to activation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway by AKT phosphorylation. We aim to
Saravana P Selvanathan et al.
Nucleic acids research, 47(18), 9619-9636 (2019-08-09)
Connections between epigenetic reprogramming and transcription or splicing create novel mechanistic networks that can be targeted with tailored therapies. Multiple subunits of the chromatin remodeling BAF complex, including ARID1A, play a role in oncogenesis, either as tumor suppressors or oncogenes.
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.