콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU123791

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKDC

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTTCGACTTGCGTGTGATGTTGATCAGGTGACAAGGCAACTGTATGAGCCACTAGTTATGCAGCTGATTCACTGGTTCACTAACAACAAGAAATTTGAAAGTCAGGATACTGTTGCCTTACTAGAAGCTATATTGGATGGAATTGTGGACCCTGTTGACAGTACTTTAAGAGATTTTTGTGGTCGGTGTATTCGAGAATTCCTTAAATGGTCCATTAAGCAAATAACACCACAGCAGCAGGAGAAGAGTCCAGTAAACACCAAATCGCTTTTCAAGCGACTTTATAGCCTTGCGCTTCACCCCAATGCTTTCAAGAGGCTGGGAGCATCACTTGCCTTTAATAATATCTACAGGGAATTCAGGGAAGAAGAGTCTCTGGTGGAACAGTTTGTGTTTGAAGCCTTGGTGATATACATGGAGAGTCTGGCCTTAGCACATGC

Ensembl | 인체 수납 번호

ENSG00000121031

NCBI 수납 번호

NM_001081640

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PRKDC(5591) , PRKDC(5591)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xing-Mei Liang et al.
Acta pharmacologica Sinica, 42(4), 648-654 (2021-01-09)
The third-generation of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), represented by osimertinib, has achieved remarkable clinical outcomes in the treatment of non-small-cell lung cancer (NSCLC) with EGFR mutation. However, resistance eventually emerges in most patients and the underlying
Sonia Paget et al.
Oncotarget, 8(2), 2916-2935 (2016-12-10)
The tumor suppressor gene HIC1 (Hypermethylated In Cancer 1) encodes a transcriptional repressor mediating the p53-dependent apoptotic response to irreparable DNA double-strand breaks (DSBs) through direct transcriptional repression of SIRT1. HIC1 is also essential for DSB repair as silencing of
Lin Jia et al.
The Journal of pathology, 243(2), 255-266 (2017-08-05)
Endostatin was discovered as an endogenous angiogenesis inhibitor with broad-spectrum antitumour activities. Although clinical efficacy was observed when endostatin was combined with standard chemotherapy for non-small cell lung cancer (NSCLC), as well as other cancer types, the specific mechanisms underlying
Shuai Li et al.
The FEBS journal, 286(12), 2341-2354 (2019-03-27)
Synthetic biology employs engineering principles to redesign biological systems for biomedical or industrial purposes. Innovation and application of original biological parts for genetic circuit construction will significantly facilitate and expedite the development of synthetic biology. Here, we built two- or
Emanuela Dylgjeri et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5623-5637 (2019-07-04)
DNA-dependent protein kinase catalytic subunit (DNA-PK) is a pleiotropic kinase involved in DNA repair and transcriptional regulation. DNA-PK is deregulated in selected cancer types and is strongly associated with poor outcome. The underlying mechanisms by which DNA-PK promotes aggressive tumor
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.