콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU150431

Sigma-Aldrich

MISSION® esiRNA

targeting human NOTCH1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCTACGAGTGTGCCTGTGAGCCGGGCTACACAGGGAGCATGTGTAACATCAACATCGATGAGTGTGCGGGCAACCCCTGCCACAACGGGGGCACCTGCGAGGACGGCATCAATGGCTTCACCTGCCGCTGCCCCGAGGGCTACCACGACCCCACCTGCCTGTCTGAGGTCAATGAGTGCAACAGCAACCCCTGCGTCCACGGGGCCTGCCGGGACAGCCTCAACGGGTACAAGTGCGACTGTGACCCTGGGTGGAGTGGGACCAACTGTGACATCAACAACAATGAGTGTGAATCCAACCCTTGTGTCAACGGCGGCACCTGCAAAGACATGACCAGTGGCTACGTGTGCACCTGCCGGGAGGGCTTCAGCGGTCCCAACTGCCAGACCAACATCAACGAGTGTGCGTCCAACCCATGTCTGAACCAGGGCACGTGTATTGACGACGTTGCCGGGTACAAGTGCAACTGCCT

Ensembl | 인체 수납 번호

ENSG00000148400

NCBI 수납 번호

NM_017617

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NOTCH1(4851) , NOTCH1(4851)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Keqiang Zhang et al.
The American journal of pathology, 188(1), 242-251 (2017-10-19)
Flap endonuclease 1 (FEN1) plays a crucial role in both DNA replication and damage repair. In this study, FEN1 expression and its clinical-pathologic significance in non-small-cell lung cancer (NSCLC) was investigated. Quantitative RT-PCR and immunohistochemistry analysis identified that both FEN1
Jun Yang et al.
Frontiers of medicine, 14(3), 305-317 (2019-12-31)
Familial acne inversa (AI) is an autoinflammatory disorder that affects hair follicles and is caused by loss-of-function mutations in γ-secretase component genes. We and other researchers showed that nicastrin (NCSTN) is the most frequently mutated gene in familial AI. In
Debarshi Banerjee et al.
Cancer research, 75(8), 1592-1602 (2015-03-07)
The Notch pathway plays multiple key roles in tumorigenesis, and its signaling components have therefore aroused great interest as targets for emerging therapies. Here, we show that inhibition of Notch, using a soluble receptor Notch1 decoy, unexpectedly caused a remarkable
Yinan Liu et al.
PloS one, 9(10), e109588-e109588 (2014-10-15)
The Notch signaling pathway plays versatile roles during heart development. However, there is contradictory evidence that Notch pathway either facilitates or impairs cardiomyogenesis in vitro. In this study, we developed iPSCs by reprogramming of murine fibroblasts with GFP expression governed
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.