Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU004071

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP2E1

Sign Into View Organizational & Contract Pricing
All Photos(1)
UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGTCATAGCCGACATCCTCTTCCGCAAGCATTTTGACTACAATGATGAGAAGTTTCTAAGGCTGATGTATTTGTTTAATGAGAACTTCCACCTACTCAGCACTCCCTGGCTCCAGCTTTACAATAATTTTCCCAGCTTTCTACACTACTTGCCTGGAAGCCACAGAAAAGTCATAAAAAATGTGGCTGAAGTAAAAGAGTATGTGTCTGAAAGGGTGAAGGAGCACCATCAATCTCTGGACCCCAACTGTCCCCGGGACCTCACCGACTGCCTGCTCGTGGAAATGGAGAAGGAAAAGCACAGTGCAGAGCGCTTGTACACAATGGACGGTATCACCGTGACTGTGGCCGACCTGTTCTTTGCGGGGACAGAGACCACCAGCACAACTCTGAGATATGGGCTCCTGATTCTCATGAAATACCCTGAGATTGAAGAGAAGCTCCATGAAGAAATTGACAGGGTGATTGGGCCAAGCCGAATCCCTGCCATCAAGGATAGGCAAGAGATGCCCTACATGGATGCTGTGGTGCATGAGATTCAGCGGTTCATCACC

Ensembl | human accession no.

ENSG00000130649

NCBI accession no.

NM_000773

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CYP2E1(1571) , CYP2E1(93426)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoshio Ijiri et al.
Xenobiotica; the fate of foreign compounds in biological systems, 48(1), 60-72 (2017-01-14)
1. Drug-induced liver injury is difficult to predict at the pre-clinical stage. This study aimed to clarify the roles of caspase-8 and -9 in CYP2E1 metabolite-induced liver injury in both rats and cell cultures in vitro treated with carbon tetrachloride (CCl
Lu Li et al.
International journal of oncology, 50(5), 1832-1838 (2017-03-25)
Although vitamin K2 (VK2) exhibits inhibitory effects on the viability of hepatoma cells, hepatoma cells are insensitive to VK2. Therefore, this investigation is an attempt to enhance the sensitivity of hepatoma cells to VK2. Our results showed that VK2 acted
Beomseok Son et al.
American journal of physiology. Lung cellular and molecular physiology, 313(5), L916-L929 (2017-08-12)
Radiation-induced pulmonary fibrosis (RIPF) is one of the most common side effects of lung cancer radiotherapy. This study was conducted to identify the molecular mechanism responsible for RIPF. We revealed that the transcriptional level of cytochrome P450 2E1 (CYP2E1) was
Dahlia Triningsih et al.
Toxicology in vitro : an international journal published in association with BIBRA, 72, 105105-105105 (2021-02-06)
Acrylamide is known as a neurotoxicant found in commonly consumed food as well as in human body. However, the underlying mechanisms involved in neurotoxicity by acrylamide and its metabolite, glycidamide remain largely unknown. In this study, we have examined the
Liliana Mancio-Silva et al.
Cell metabolism, 29(3), 727-735 (2019-03-07)
The liver plays a central role in metabolism; however, xenobiotic metabolism variations between human hepatocytes and those in model organisms create challenges in establishing functional test beds to detect the potential drug toxicity and efficacy of candidate small molecules. In

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service