Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU009821

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tao Wang et al.
Molecular and cellular biochemistry, 413(1-2), 179-187 (2016-01-29)
The prolyl isomerase Pin1, which is frequently highly expressed in many different cancers, can directly regulate cell proliferation and the cell cycle. However, the role of Pin1 in chemo-resistance remains to be elucidated in cervical cancer. The purpose of the
Deyu Zeng et al.
Journal of cellular biochemistry, 119(2), 1855-1865 (2017-08-13)
Pancreatic cancer is one of the major human malignant tumors severely endangering human health and life with high mortality due to the concealment of early symptoms and lack of effective therapies during advanced stages. The identification of pancreatic cancer stem
Rui-Tao Wang et al.
World journal of gastroenterology, 27(8), 692-707 (2021-03-16)
Gallbladder cancer (GBC) is an aggressive type of biliary tract cancer that lacks effective therapeutic targets. Fork head box M1 (FoxM1) is an emerging molecular target associated with tumor progression in GBC, and accumulating evidence suggests that vascular endothelial growth
Jingjing Zhang et al.
Gynecologic and obstetric investigation, 84(5), 485-494 (2019-05-01)
The aim of this study was to investigate the expression of Forkhead box M1 (FoxM1) in endometriosis and determine FoxM1's possible effects on endometriotic epithelial cells (EECs) invasion and epithelial-mesenchymal transition (EMT). The expression of FoxM1 and E-cadherin in endometrium
Xinping Yang et al.
American journal of translational research, 10(2), 629-638 (2018-03-08)
The FoxM1 (Forkhead Box M1) transcription factor plays a key role in regulation of cell growth, cell cycle, and transformation. Higher expression of FoxM1 has been observed in various types of human cancers including bladder cancer. However, the exact function

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service