Sign In to View Organizational & Contract Pricing
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGCAGATGCCAGTGGAAATGTCCAGGCCAGCAGTACCACTTCTGAACTCCAACAACGAGAAAATGTCAGATCCCAATATGGAAGCTAACAGTCATTACGGTCACAATGACGATGTCAGAAACCATGCAATGAAACCAATAAATGATAATAAAGAGCCTCTGAACTCAGACGTGCAGTACACGGAAGTTCAAGTGTCCTCAGCTGAGTCTCACAAAGATCTAGGAAAGAAGGACACAGAGACAGTGTACAGTGAAGTCCGGAAAGCTGTC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PECAM1(5175), PECAM1(5175)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hsu-Tung Lee et al.
Theranostics, 7(4), 855-875 (2017-04-07)
Inflammatory processes have a detrimental role in the pathophysiology of ischemic stroke. However, little is known about the endogenous anti-inflammatory mechanisms in ischemic brain. Here, we identify CXCL14 as a critical mediator of these mechanisms. CXCL14 levels were upregulated in
Claudia Strobel et al.
Beilstein journal of nanotechnology, 5, 1795-1807 (2014-11-11)
Cerium dioxide (CeO2) and silicon dioxide (SiO2) nanoparticles are of widespread use in modern life. This means that human beings are markedly exposed to them in their everyday life. Once passing biological barriers, these nanoparticles are expected to interact with
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service