MilliporeSigma
All Photos(1)

Documents

EHU114901

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF4

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU006361EHU058351EHU092591
MISSION® esiRNA targeting human ATF4

EHU114901

MISSION® esiRNA

MISSION® esiRNA targeting human ATF1

EHU006361

MISSION® esiRNA

MISSION® esiRNA targeting human TAF4

EHU058351

MISSION® esiRNA

MISSION® esiRNA targeting human ATF3 (1)

EHU092591

MISSION® esiRNA

esiRNA cDNA target sequence

CCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCT

esiRNA cDNA target sequence

CAACCTGGTTCAGCAGTTCAGGGAGCTCACATTTCTCATATTGCTCAACAGGTATCATCTTTATCAGAAAGTGAGGAGTCCCAGGACTCATCCGACAGCATAGGCTCCTCACAGAAAGCCCACGGGATCCTAGCACGGCGCCCATCTTACAGAAAAATTTTGAAAGACTTATCTTCTGAAGATACACGGGGCAGAAAAGGAGACGGAGAAAATTCTGGAGTTTCTGCTGCTGTCACTTCTATGTCTGTTCCAACTCCCATCTATCAGACTAGCAGCGGACAGTACATTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCATGACAAATTCAGGCAGTACTCAGCAAGGTACAACTATTCTTCAGTATGCACAGACCTCTGATGGACAGCAGATACTTGTGCCCAGCAATCAGGTGGTCGTACAAACTGCATCAGGAGATATGCAAACATATCAGATCCGAACTACACCTTCAGCTACTTCTCTGCCACAAACTGTGG

esiRNA cDNA target sequence

TGAGACAAGCCATTCACTGCTGCTCTACAAAGCATTCCTTAAGTGACACAGGAGGACGCCTGGGGACTTTTTATATATTTGCAGATTACGCCTTTTTGTAACGAGCAAATGGGATATTGTTTAAAAAACAGCCACCTCTTTACAATGGAACAGTTTTATATTCCTGTTTCTAAATCAGCTCTTCAGTGTGAAAGAAAACACGTTTCTGTAACAGAGAGAACACAAAGGCCTGTGGATACTCTTAAAGGACAATTAAATCTTAACTCATCTTGATTGAGTGGCCTTCCTGCCAAACAAGCCATATATAAAGACTGATGGAATCGTTAGCAAATAATTAGCTGCCCTCTGTCAACTCATAGCAGTTTCTGCATTATTTGTGCATTTTGGTTTAGTTCTACCTAACTTACTATGTAGGTGTATGTCTACAGCCGATGACCTCATTTC

esiRNA cDNA target sequence

TTTTTCTCAGATCTGGTTTCTAAGAGTTTTGGGGGGCGGGGCTGTCACCACGTGCAGTATCTCAAGATATTCAGGTGGCCAGAAGAGCTTGTCAGCAAGAGGAGGACAGAATTCTCCCAGCGTTAACACAAAATCCATGGGCAGTATGATGGCAGGTCCTCTGTTGCAAACTCAGTTCCAAAGTCACAGGAAGAAAGCAGAAAGTTCAACTTCCAAAGGGTTAGGACTCTCCACTCAATGTCTTAGGTCAGGAGTTGTGTCTAGGCTGGAAGAGCCAAAGAATATTCCATTTTCCTTTCCTTGTGGTTGAAAACCACAGTCAGTGGAGAGATGTTTGGAAACCACAGTCAGTGGAGCCTGGGTGGTACCCAGGCTTTAGCATTATTGGATGTCAATAGCA

Ensembl | human accession no.

ENSG00000128272

Ensembl | human accession no.

ENSG00000123268

Ensembl | human accession no.

ENSG00000130699

Ensembl | human accession no.

ENSG00000162772

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

NCBI accession no.

NM_001675

NCBI accession no.

NM_005171

NCBI accession no.

NM_003185

NCBI accession no.

NM_001040619

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Zhen Ren et al.
Toxicological sciences : an official journal of the Society of Toxicology, 154(2), 368-380 (2016-09-11)
Nefazodone, an antagonist for the 5-hydroxytryptanine receptor, has been used for the treatment of depression. Acute liver injury has been documented to be associated with the use of nefazodone; however, the mechanisms of nefazodone-induced liver toxicity are not well defined.
Ritesh K Srivastava et al.
Toxicology and applied pharmacology, 308, 46-58 (2016-07-28)
Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here
Kimberly M Alonge et al.
The Journal of biological chemistry, 292(13), 5239-5252 (2017-02-12)
Previous studies have shown that glucagon cooperatively interacts with insulin to stimulate hepatic FGF21 gene expression. Here we investigated the mechanism by which glucagon and insulin increased FGF21 gene transcription in primary hepatocyte cultures. Transfection analyses demonstrated that glucagon plus
Yoko Tabe et al.
Scientific reports, 8(1), 16837-16837 (2018-11-18)
Adipocytes are the prevalent stromal cell type in adult bone marrow (BM), and leukemia cells continuously adapt to deficiency of nutrients acquiring chemoresistant profiles in the BM microenvironment. We have previously shown that fatty acid metabolism is a key energy
Wolfgang Fischer et al.
Redox biology, 21, 101089-101089 (2018-12-31)
Alzheimer's disease (AD) is the most frequent age-associated dementia with no treatments that can prevent or slow its progression. Since age is by far the major risk factor for AD, there is a strong rationale for an alternative approach to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service