Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU158801

Sigma-Aldrich

MISSION® esiRNA

targeting human MYLK (1)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAGAATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTGCTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTGTCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATCTGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAACGTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTATGGAACCAGTGAGCCA

Ensembl | human accession no.

ENSG00000065534

NCBI accession no.

NM_053027

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYLK(4638) , MYLK(4638)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sho Hiroyasu et al.
Journal of cell science, 130(14), 2329-2343 (2017-06-10)
During healing of the skin, the cytoskeleton of keratinocytes and their matrix adhesions, including focal adhesions (FAs), undergo reorganization. These changes are coordinated by small GTPases and their regulators, including the guanine nucleotide exchange factor β-PIX (also known as ARHGEF7).
Nityanand Srivastava et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12805-12819 (2020-08-11)
Increased endothelial permeability leads to excessive exudation of plasma proteins and leukocytes in the interstitium, which characterizes several vascular diseases including acute lung injury. The myosin light chain kinase long (MYLK-L) isoform is canonically known to regulate the endothelial permeability
Shaoqing Chen et al.
Journal of cellular physiology, 235(11), 7757-7768 (2019-11-20)
Long noncoding RNAs (lncRNAs) play a crucial role in several malignances, involving nasopharyngeal carcinoma (NPC), a heterogeneous disease. This study investigated mechanism of serine/arginine repetitive matrix protein 2-alternative splicing (SRRM2-AS) in NPC cell proliferation, differentiation, and angiogenesis. Initially, differentially expressed
A Martinsen et al.
Pflugers Archiv : European journal of physiology, 466(7), 1377-1389 (2013-10-29)
The Ca(2+)-dependent kinase myosin light chain kinase (MLCK) is the activator of smooth muscle contraction. In addition, it has been reported to be involved in Ca(2+) channel regulation in cultured cells, and we previously showed that the MLCK inhibitor ML-7

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service