MilliporeSigma
All Photos(1)

Documents

EHU021051

Sigma-Aldrich

MISSION® esiRNA

targeting human MYC

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU051201EHU094591EHU133301
MISSION® esiRNA targeting human MYC

EHU021051

MISSION® esiRNA

MISSION® esiRNA targeting human MYBL1

EHU051201

MISSION® esiRNA

MISSION® esiRNA targeting human MYB

EHU094591

MISSION® esiRNA

MISSION® esiRNA targeting human MYH11

EHU133301

MISSION® esiRNA

Ensembl | human accession no.

ENSG00000136997

Ensembl | human accession no.

ENSG00000185697

Ensembl | human accession no.

ENSG00000118513

Ensembl | human accession no.

ENSG00000133392

Gene Information

human ... MYC(4609), MYC(4609)

Gene Information

human ... MYBL1(4603), MYBL1(4603)

Gene Information

human ... MYB(4602), MYB(4602)

Gene Information

human ... MYH11(4629), MYH11(4629)

esiRNA cDNA target sequence

CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG

esiRNA cDNA target sequence

TCCTGGACAGAAGAGGAGGACAGGATCATCTATGAAGCACATAAGCGGTTGGGAAATCGTTGGGCAGAAATTGCCAAACTACTTCCAGGAAGGACTGATAATTCTATCAAAAATCATTGGAATTCTACTATGCGAAGAAAAGTGGAACAGGAGGGCTATTTACAAGATGGAATAAAATCAGAACGATCTTCATCTAAACTTCAACACAAACCTTGTGCAGCTATGGATCATATGCAAACCCAGAATCAGTTTTACATACCTATCCCTGGGTATCAGTATGTGTCACCTGAAGGCAATTGTATAGAACATGTTCAGCCTACTTCTGCCTTTATTCAGCAACCCTTCATTGATGAAGATCCTGATAAGGAAAAGAAAATAAAGGAACTTGAGATGCTTCTTATGTCAGCTGAGAATGAAGTTAGAAGAAAGCGAATTCCATCACAGCCTGGAAG

esiRNA cDNA target sequence

GGGCAGTAGAGCTTGGACAGAAAGAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCCTGTGTT

esiRNA cDNA target sequence

AACTTCGACGTCACGGGTTACATCGTGGGAGCCAACATTGAGACCTATCTGCTAGAAAAATCACGGGCAATTCGCCAAGCCAGAGACGAGAGGACATTCCACATCTTTTACTACATGATTGCTGGAGCCAAGGAGAAGATGAGAAGTGACTTGCTTTTGGAGGGCTTCAACAACTACACCTTCCTCTCCAATGGCTTTGTGCCCATCCCAGCAGCCCAGGATGATGAGATGTTCCAGGAAACCGTGGAGGCCATGGCAATCATGGGTTTCAGCGAGGAGGAGCAGCTATCCATATTGAAGGTGGTATCATCGGTCCTGCAGCTTGGAAATATCGTCTTCAAGAAGGAAAGAAACACAGACCAGGCGTCCATGCCAGATAACACAGCTGCTCAGAAAGTTTGCCACCTCATGG

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

NCBI accession no.

NM_002467

NCBI accession no.

-

NCBI accession no.

NM_005375

NCBI accession no.

NM_001040113

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Feifei Zhang et al.
EBioMedicine, 44, 311-321 (2019-05-13)
Gastric cancer (GC) ranks the fifth most common cancer, and chemotherapy is one of the most common treatments for GC. However, chemoresistance limits the effectiveness of chemotherapy and leads to treatment failure. This study aims to investigate the biological effect
Xuyang Wang et al.
World journal of gastroenterology, 23(18), 3252-3261 (2017-06-02)
To determine the role of hepatitis B virus X protein (HBx), HBx in regulating hepatic progenitor cell (HPC)-like features in hepatocellular carcinoma (HCC) and the underlying molecular mechanisms. We used a retrovirus vector to introduce wild type HBx or empty
Yili Tao et al.
Scientific reports, 8(1), 14477-14477 (2018-09-29)
Colorectal cancer (CRC) is among the most frequently occurring cancers worldwide. Baicalin is isolated from the roots of Scutellaria baicalensis and is its dominant flavonoid. Anticancer activity of baicalin has been evaluated in different types of cancers, especially in CRC.
Juanjuan Liu et al.
Annals of biomedical engineering, 45(6), 1407-1419 (2017-03-30)
Melanoma is a potentially lethal skin cancer with high mortality rate. Recently, the peptide-mediated transdermal delivery of small interference RNA (siRNA) emerges as a promising strategy to treat melanoma by inducing the apoptosis of tumor cells, but the related theoretical
Martina Godel et al.
International journal of molecular sciences, 21(12) (2020-07-01)
Doxorubicin (Dox) is one of the most important first-line drugs used in osteosarcoma therapy. Multiple and not fully clarified mechanisms, however, determine resistance to Dox. With the aim of identifying new markers associated with Dox-resistance, we found a global up-regulation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service