추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCACCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCTCTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAATGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATGCAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTCAAGAACAAGTATGCCACATCGAAGCATG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CCNB1(891) , CCNB1(891)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jinglan Jin et al.
Frontiers in bioengineering and biotechnology, 8, 54-54 (2020-03-07)
Hepatocellular carcinoma (HCC) is one of the important types of liver cancer. LncRNA is an important regulatory factor that regulates many biological processes such as tumor cells during tumorigenesis and metastasis. LINC00346 has been associated with various types of liver
Min Li et al.
World journal of gastroenterology, 27(10), 939-958 (2021-03-30)
Hepatocellular carcinoma (HCC) is one of the most prevalent cancers in human populations worldwide. Huanglian decoction is one of the most important Chinese medicine formulas, with the potential to treat cancer. To investigate the role and mechanism of Huanglian decoction
Daniel Hayward et al.
The Journal of cell biology, 218(4), 1182-1199 (2019-01-25)
Spindle checkpoint signaling is initiated by recruitment of the kinase MPS1 to unattached kinetochores during mitosis. We show that CDK1-CCNB1 and a counteracting phosphatase PP2A-B55 regulate the engagement of human MPS1 with unattached kinetochores by controlling the phosphorylation status of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.