콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU032191

Sigma-Aldrich

MISSION® esiRNA

targeting human GSDMD

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGTTCTGGAAACCCCGTTATAAGTGTGTCAACCTGTCTATCAAGGACATCCTGGAGCCGGATGCCGCGGAACCAGACGTGCAGCGTGGCAGGAGCTTCCACTTCTACGATGCCATGGATGGGCAGATACAGGGCAGCGTGGAGCTGGCAGCCCCAGGACAGGCAAAGATCGCAGGCGGGGCCGCGGTGTCTGACAGCTCCAGCACCTCAATGAATGTGTACTCGCTGAGTGTGGACCCTAACACCTGGCAGACTCTGCTCCATGAGAGGCACCTGCGGCAGCCAGAACACAAAGTCCTGCAGCAGCTGCGCAGCCGCGGGGACAACGTGTACGTGGTGACTGAGGTGCTGCAGACACAGAAGGAGGTGGAAGTCACGCGCACCCACAAGCGGGAGGGCTCGGGCCGGTTTTCCCTGCCCGGAGCCACGTGCTTGCAGGGTGAGGGCCAGGGCCATCTGAGCCAGAAGAAGACGGTC

Ensembl | 인체 수납 번호

ENSG00000104518

NCBI 수납 번호

NM_024736

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... GSDMD(79792) , GSDMD(79792)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
MAV

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Guangxue Gu et al.
International immunopharmacology, 91, 107227-107227 (2020-12-29)
Ankylosing spondylitis (AS) is a disease characterized by inflammation of the sacroiliac joint and the attachment point of the spine. This study aimed to investigate the effect of microRNA (miR)-204-targeted GSDMD on fibroblast-like synoviocytes (FLSs) in AS. miR-204, GSDMD, pyrolysis-related
Jianwei Gao et al.
Oncology reports, 40(4), 1971-1984 (2018-08-15)
Gasdermin D (GSDMD) is a newly discovered pyroptosis executive protein, which can be cleaved by inflammatory caspases and is essential for secretion of IL‑1β, making it a critical mediator of inflammation. However, the precise role of GSDMD in carcinogenesis remains nearly
Wenyi Zhao et al.
Experimental eye research, 202, 108375-108375 (2020-12-07)
The protein GSDMD is an important performer of pyroptosis and a universal substrate for the inflammatory caspase. However, the role and regulatory mechanism of GSDMD in Aspergillus fumigatus keratitis is remains unknown. Here we detected GSDMD protein in the cornea
Hui Chen et al.
Molecular neurodegeneration, 15(1), 26-26 (2020-04-17)
Acute glaucoma, characterized by a sudden elevation in intraocular pressure (IOP) and retinal ganglion cells (RGCs) death, is a major cause of irreversible blindness worldwide that lacks approved effective therapies, validated treatment targets and clear molecular mechanisms. We sought to

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.