MilliporeSigma
All Photos(1)

Documents

EHU141651

Sigma-Aldrich

MISSION® esiRNA

targeting human ESR1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU031231EHU115631EHU156461
MISSION® esiRNA targeting human ESR1

Sigma-Aldrich

EHU141651

MISSION® esiRNA

MISSION® esiRNA targeting human ESD

Sigma-Aldrich

EHU031231

MISSION® esiRNA

MISSION® esiRNA targeting human EWSR1

Sigma-Aldrich

EHU115631

MISSION® esiRNA

MISSION® esiRNA targeting human SZRD1

Sigma-Aldrich

EHU156461

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT

esiRNA cDNA target sequence

ACCACCAAAGGCAGAAACAGGAAAGTGCCCTGCACTGTATTGGCTCTCAGGTTTAACTTGCACAGAGCAAAATTTTATATCAAAATCTGGTTATCATCAGTCTGCTTCAGAACATGGTCTTGTTGTCATTGCTCCAGATACCAGCCCTCGTGGCTGCAATATTAAAGGTGAAGATGAGAGCTGGGACTTTGGCACTGGTGCTGGATTTTATGTTGATGCCACTGAAGATCCTTGGAAAACCAACTACAGAATGTACTCTTATGTCACAGAGGAGCTTCCCCAACTCATAAATGCCAATTTTCCAGTGGATCCCCAAAGGATGTCTATTTTTGGCCACTCCATGGGAGGTCATGGAGCTCTGATCTGTGCTTTGAAAAATCCTGGAAAATACAAATCTGTGTCAGCATTTGCTCC

esiRNA cDNA target sequence

GAAGAGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGCAGCGCTGGAGAGCGAGGTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCCACCTGTAGATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAAATGACAGTGTGACTCTAGATGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAGATGAACAAGAGAACTGGGCAACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAAGCCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCACCCACTGCCAAGGCTGCCGTGGAATGGTTTGATGGGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCCCTTGCTCGGA

esiRNA cDNA target sequence

AGTCCCTAGCACAGCGAGAGGCCGAGTACGCCGAGGCCCGGAAGCGGATCCTGGGCAGCGCCAGCCCCGAGGAGGAGCAGGAGAAACCCATCCTCGACAGGCCAACCAGGATCTCCCAACCCGAAGACAGCAGGCAGCCCAATAATGTGATCAGACAGCCTTTGGGTCCTGATGGGTCTCAAGGCTTCAAACAGCGCAGATAAATGCAGGCAAGAAAAGATGCCGCCGTTGCTGCCGTCACCGCCTCCTGGGTCGTCCGCCACGGGTTGCACTGCCGTGGCAGACAGCTGGACTTGAGCAGAGGGAACGACCTGACTTACTTGCACTGTGATCCCCCTTGCTCCGCCCACTGTGACCTTGAACCCCATGCACTGTGACCTCCCCCCTTCTCCCCCTTCCCACTGTGATTGGCACATCGACAAGGGCTGTCCCAAGTCAATGGAAAGGGAA

Ensembl | human accession no.

ENSG00000091831

Ensembl | human accession no.

ENSG00000139684

Ensembl | human accession no.

ENSG00000182944

Ensembl | human accession no.

ENSG00000055070

NCBI accession no.

NM_000125

NCBI accession no.

NM_001984

NCBI accession no.

NM_013986

NCBI accession no.

NM_015609

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Sarah R Hosford et al.
Molecular oncology, 13(8), 1778-1794 (2019-06-11)
Estrogens have been shown to elicit anticancer effects against estrogen receptor α (ER)-positive breast cancer. We sought to determine the mechanism underlying the therapeutic response. Response to 17β-estradiol was assessed in ER+ breast cancer models with resistance to estrogen deprivation:
Kenji Watanabe et al.
Scientific reports, 8(1), 16000-16000 (2018-10-31)
Breast cancer is the most frequent tumor in women, and in nearly two-thirds of cases, the tumors express estrogen receptor α (ERα, encoded by ESR1). Here, we performed whole-exome sequencing of 16 breast cancer tissues classified according to ESR1 expression
Shan Gao et al.
Frontiers in oncology, 10, 753-753 (2020-06-06)
Background: Dysregulation of ESR1 accounts for endocrine therapy resistance and metastasis of ERα positive breast cancer. However, the underlying molecular mechanism of ESR1 in ERα positive breast cancer remains insufficiency. Notably, to date, a comprehensive miRNA-mRNA regulatory network involved in
Keivan Mobini et al.
Journal of biochemical and molecular toxicology, e22304-e22304 (2019-02-20)
The underlying functions of miR-206, miR-133a, miR-27b, and miR-21, and their link to the estrogen receptor alpha (ERα) and aryl hydrocarbon receptor (AhR) signaling pathways remain largely unexplored. In this study, we detect the expression of miR-206, miR-133a, miR-27b, and
Fang Liu et al.
Molecular diagnosis & therapy, 22(5), 551-569 (2018-06-22)
Small interfering RNAs (siRNAs) are an attractive new agent with potential as a therapeutic tool because of its ability to inhibit specific genes for many conditions, including viral infections and cancers. However, despite this potential, many challenges remain, including off-target

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service